MemeXpert Search
Untitled meme

Meme detail

About this meme

Text detected in the image

Scientists Have Discovered Hidden Annotations In DNA Code Left By God And It C Will Terrify You : human_7605232288.exe Eile Edit Help //made he mouth way too big lmao //im leavin it in LOL CGTAGCTAGTCATGCAGATGGTATGGTCCTTA GAAATCGCCGTTGGGCAGAAATTTATCCGGAG //this guy is gonna be so DUMB CCGTTACGCTTGATGATATGGTGGAGTGCCGT GAATCGCCGAAGTAGCGTTGGGTCGGATCGAT AAGTCCTAGTGCGTATACAGGTTTCCCGCGTA //im just put some baboon code in here n see what happens CGAGTGCTGATCGTGGGTAATTGGTCGGTCAT //spent 7 hours writing this part just to fuck up his toes CCGTTTAGCGGTGAGCGAGTTGCGATTCGTGA GGTGGAGTCGAGTGGGTGAGCGTAGGCGTAGC Posted in r/ProgrammerHumor reddit

Popularity

0 views 0 sends 0 likes 0 saves
Sources & activity 1 Telegram post across 1 channel 13 views unknown reactions 0 reposts 0 recorded signals

Observed Telegram posts

Every public-crawler post we observed for this meme. Totals add only known counters; “Unknown” means Telegram did not expose a value, not zero.

Showing 1–1 of 1

Views13
ReactionsUnknown
CommentsUnknown
Reposts0

Interaction rate Unknown · Audience at publish Unknown · Views per 1,000 subscribers Unknown

Counters frozen at this list snapshot: Sep 7, 2026, 6:09 PM UTC.

For social media specialists Professional analytics Trends, normalized performance, channel-audience context, and separate web/Telegram funnels.

Recorded activity counts observable signals, not unique people or reach. Impressions, inline results, comments, downloads, and subscriber counts remain separate from Recorded activity and popularity.

Refreshed Sep 7, 2026, 6:09 PM UTC

History is still sparse. Totals are real, but trend comparisons need more observations and should be read cautiously.

Recorded activity

0

0 per day

7-day momentum

0

Unknown vs previous 7 days

Peak bucket

Unknown

More history needed

Current favorites

0

Current state, outside the selected-period total

Recorded activity · signals per day Each day, week, or month bucket is divided by its duration so adaptive all-time history remains comparable. Downloads stay excluded; exact bucket totals follow below.

Not enough activity history yet

At least two buckets, including one with Recorded activity, are needed for a trend line. Exact zero and raw-total buckets remain in the data table.

Telegram counter
Observed Telegram views Absolute server-bucketed end states, stamped at the last real capture in each bucket; the opening baseline is as of the range start. Missing values break the line.

Not enough known views yet

At least two known bucket-end values are needed for a line. Switch counters or return after more observations.

View chart data
Exact Recorded activity buckets
Bucket startBucket endGranularityDurationRecorded totalSource totalMemeExpert totalSignals/day
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Day1 day0000
Server-bucketed Telegram end states at the last capture in each bucket
Observed / as ofViewsReactionsCommentsReposts
13UnknownUnknown0

Telegram performance

Current observed totals and ratio-of-sums over eligible posts.

13 views · unknown reactions · 0 reposts

Reaction rate
Unknown · 0 of 1 posts eligible
Comment rate
Unknown · 0 of 1 posts eligible
Repost rate
0% · 1 of 1 posts eligible
Combined interaction rate
Unknown · 0 of 1 posts eligible

Channel audience context

Forward-only subscriber observations; today’s audience is never applied to historical posts.

Current audience known
1 of 1 channels
Comparable channels in range
1
Known subscriber change
0
Views per 1,000 subscribers
Unknown · 0 of 1 posts eligible
Interactions per 1,000 subscribers
Unknown · 0 of 1 posts eligible

Exposure funnels

Distinct matched exposure tokens, split by surface. These figures do not enter Recorded activity.

Web cards

0 impressions · 0 attributed

0 detail clicks (Unknown)

0 high-intent actions (Unknown)

Telegram inline

0 results served · 0 attributed

0 chosen (Unknown)

0 sent (Unknown)

Coverage is partial whenever a counter or subscriber snapshot was unavailable. Source totals are sums of known post counters and may overlap across channels; they are neither unique viewers nor estimated reach. Downloads in this range: 0.

Similar memes

Keep exploring with more memes from the catalog.

Showing 12 of 200

Automatic loading is unavailable in this browser, so use Load more.